| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.096333 |
| Chromosome: | chromosome 11 |
| Location: | 2917206 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g478000 | (1 of 18) IPR001041 - 2Fe-2S ferredoxin-type iron-sulfur binding domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCAAGCCATCAGTCATCAGTCAGATCAA |
| Internal bar code: | TAACTGCGGCTATCCAAACCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 133 |
| LEAP-Seq percent confirming: | 95.8092 |
| LEAP-Seq n confirming: | 4641 |
| LEAP-Seq n nonconfirming: | 203 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAACCCGATCTGCAACTTCC |
| Suggested primer 2: | TCAAGCAGGAGCACACTTTG |