Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.096333 |
Chromosome: | chromosome 11 |
Location: | 2917206 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g478000 | (1 of 18) IPR001041 - 2Fe-2S ferredoxin-type iron-sulfur binding domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCAAGCCATCAGTCATCAGTCAGATCAA |
Internal bar code: | TAACTGCGGCTATCCAAACCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 133 |
LEAP-Seq percent confirming: | 95.8092 |
LEAP-Seq n confirming: | 4641 |
LEAP-Seq n nonconfirming: | 203 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAACCCGATCTGCAACTTCC |
Suggested primer 2: | TCAAGCAGGAGCACACTTTG |