| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.096349 |
| Chromosome: | chromosome 13 |
| Location: | 478087 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g564950 | EFG13 | (1 of 1) K14536 - ribosome assembly protein 1 (RIA1); Ribosomal protein S5/Elongation Factor G/III/V family protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGTTCGCAGGGCCGATGAGGGACGGTGT |
| Internal bar code: | ATGACGGGGCCTCGCCAATCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 41 |
| LEAP-Seq percent confirming: | 77.6665 |
| LEAP-Seq n confirming: | 1318 |
| LEAP-Seq n nonconfirming: | 379 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTAGTCCGTTGCACCTTGC |
| Suggested primer 2: | TTCTTGCTATTGGTCTGGGG |