| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.096380 |
| Chromosome: | chromosome 9 |
| Location: | 6599705 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g408428 | UMAMIT (Usually Multiple Acids Move In and Out Transporters) type transporter; (1 of 3) PTHR11132//PTHR11132:SF125 - SOLUTE CARRIER FAMILY 35 // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAGGCTGCAAAGCCCACCATACTAATGC |
| Internal bar code: | CGGTTGTGGGGGCATTTCGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 574 |
| LEAP-Seq percent confirming: | 94.6899 |
| LEAP-Seq n confirming: | 9023 |
| LEAP-Seq n nonconfirming: | 506 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTTCGGCGGCAATATCTA |
| Suggested primer 2: | CACGTGAAGCCCACAGAGTA |