Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.096408 |
Chromosome: | chromosome_7 |
Location: | 1957442 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre07.g325751 | FAP258 | Similar to Flagellar Associated Protein FAP258 | sense | 3'UTR |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | TGTGAGGGTACTGCCTAGGTACCAACTTGT |
Internal bar code: | AGTTTAGCCGATTTTACTCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 354 |
LEAP-Seq percent confirming: | 94.6927 |
LEAP-Seq n confirming: | 1017 |
LEAP-Seq n nonconfirming: | 57 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTGGATGACTACGCGAATG |
Suggested primer 2: | AGAAGCTACGGGAGAGGAGG |