| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.096532 |
| Chromosome: | chromosome 7 |
| Location: | 2291684 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g327750 | TRP3 | Transient receptor potential ion channel protein; (1 of 6) PTHR31942//PTHR31942:SF1 - FAMILY NOT NAMED // MLO-LIKE PROTEIN 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATCACGCCTCTTGACGCCCAGAGACCGA |
| Internal bar code: | AGCCGTCCCCCCGACCCCGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 677 |
| LEAP-Seq percent confirming: | 99.42 |
| LEAP-Seq n confirming: | 4114 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAGCAAAAGCTGCCGTAT |
| Suggested primer 2: | GGTGGAGAAGCTGAACAAGC |