| Insertion cassette: | CIB1 | 
| Side of cassette: | 3' | 
| Strand: | - | 
| Strain: | LMJ.RY0402.096584 | 
| Chromosome: | chromosome 5 | 
| Location: | 895508 | 
| Confidence (%): | 58 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre05.g247450 | CGL56,RDP5 | Putative rhodanese-like protein; (1 of 1) PTHR34209//PTHR34209:SF1 - FAMILY NOT NAMED // RHODANESE/CELL CYCLE CONTROL PHOSPHATASE SUPERFAMILY PROTEIN | intron | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGCTGGCGCGCTGGGGGTTGGGGGGTTA | 
| Internal bar code: | GACATCCGGCGGTCCGACGTAA | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 8 | 
| LEAP-Seq percent confirming: | 61.2903 | 
| LEAP-Seq n confirming: | 38 | 
| LEAP-Seq n nonconfirming: | 24 | 
| LEAP-Seq n unique pos: | 2 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTAGCTTCCTGCCCTCAC | 
| Suggested primer 2: | GGATGCACTGAAGACTGCAA |