| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.096600 |
| Chromosome: | chromosome 14 |
| Location: | 1010390 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g614300 | (1 of 1) 1.1.1.205 - IMP dehydrogenase / Inosinic acid dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGCACCCTCCGCCCCTTCGCCCCGCTC |
| Internal bar code: | ATGGACCGGACACGTCACGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 178 |
| LEAP-Seq percent confirming: | 63.0435 |
| LEAP-Seq n confirming: | 87 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTCCGCCTGTATCTCTG |
| Suggested primer 2: | ATGAGAACACGCACTTGCAC |