| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.096648 |
| Chromosome: | chromosome 10 |
| Location: | 1771795 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g430800 | (1 of 3) PTHR10566//PTHR10566:SF76 - CHAPERONE-ACTIVITY OF BC1 COMPLEX CABC1 -RELATED // PROTEIN Y32H12A.7 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACCCTCTCCACCACGCACAGGCAACCTT |
| Internal bar code: | AGCGGTCAATGCTAGGGTACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 190 |
| LEAP-Seq percent confirming: | 55.9748 |
| LEAP-Seq n confirming: | 89 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
| Suggested primer 2: | CGCCTTGAAGAAACCCATTA |