| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.096726 |
| Chromosome: | chromosome 7 |
| Location: | 838656 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318551 | CYA8 | Adenylate cyclase; (1 of 1) PF00211//PF13855 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Leucine rich repeat (LRR_8) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAAAGGTGTGACTGGTGGGAAAGTCGAT |
| Internal bar code: | ATGTTCAAACTAACTTCGGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 392 |
| LEAP-Seq percent confirming: | 98.4416 |
| LEAP-Seq n confirming: | 379 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGCAACTCACACACACAG |
| Suggested primer 2: | ACTCAAGGAGCGGTACATGG |