| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.096789 |
| Chromosome: | chromosome 16 |
| Location: | 1389809 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g652100 | MAP2 | (1 of 1) PTHR10804//PTHR10804:SF9 - PROTEASE FAMILY M24 METHIONYL AMINOPEPTIDASE, AMINOPEPTIDASE P // METHIONINE AMINOPEPTIDASE 2; Methionine aminopeptidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGTCCCACGCCCCTAAAAGCTCCAAATA |
| Internal bar code: | AGGCCCGACGCGACGTGGAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 383 |
| LEAP-Seq percent confirming: | 81.8578 |
| LEAP-Seq n confirming: | 564 |
| LEAP-Seq n nonconfirming: | 125 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGACCGCAACACCTATCT |
| Suggested primer 2: | TAGATGAGGGATGTCGAGGG |