| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.096803 |
| Chromosome: | chromosome 3 |
| Location: | 4783238 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g178350 | FAP272 | Flagellar Associated Protein 272 similar to calmodulin; (1 of 1) PTHR23050//PTHR23050:SF190 - CALCIUM BINDING PROTEIN // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAACCCTGGGAGTCAATACGACCCCCAC |
| Internal bar code: | GGGCCGGACTTATCGACTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1103 |
| LEAP-Seq percent confirming: | 99.6401 |
| LEAP-Seq n confirming: | 7199 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCTCCCTATACACCCAA |
| Suggested primer 2: | CTCAGGGAACTCCACAGCTC |