Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.096817 |
Chromosome: | chromosome 1 |
Location: | 1943383 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g010350 | LIPB1,LPL1 | (1 of 1) PTHR10993//PTHR10993:SF7 - OCTANOYLTRANSFERASE // LIPOYLTRANSFERASE 2, MITOCHONDRIAL-RELATED; Lipoate protein ligase B | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCATCGTCAATAGTATGCGATATCAGTAC |
Internal bar code: | GTTGAGTGATGTGTCCGAAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 367 |
LEAP-Seq percent confirming: | 99.295 |
LEAP-Seq n confirming: | 4789 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCACGCCTTGCCATAATCT |
Suggested primer 2: | AAGGTGAAGACCGACCACAC |