Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.096857 |
Chromosome: | chromosome 11 |
Location: | 2701617 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g476850 | PF2,DRC4,GAS8 | (1 of 1) PTHR31543//PTHR31543:SF0 - FAMILY NOT NAMED // GROWTH ARREST-SPECIFIC PROTEIN 8; Nexin-dynein regulatory complex 4 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGATACATCGCCGCGCCTACAAAGGTGCC |
Internal bar code: | CAGGTGAGTGGGATGAGCCTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 92 |
LEAP-Seq percent confirming: | 80.6122 |
LEAP-Seq n confirming: | 79 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCGTCTCAAACCCCACAAG |
Suggested primer 2: | ATGCCGAACTCTGTGAGCTT |