Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.096859 |
Chromosome: | chromosome 7 |
Location: | 1092518 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g319900 | RRP40 | 3'-5' Exonuclease component of the Exosome; (1 of 1) K03681 - exosome complex component RRP40 (RRP40, EXOSC3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCCGACCGTGCTCGCTATAACAGTCGAA |
Internal bar code: | AGGCCGCTGAGGAGGGGAGTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 333 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 25 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGATAAGTGGTGACGTGGC |
Suggested primer 2: | CTGCCTGGACAGGGTATGTT |