| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.096864 |
| Chromosome: | chromosome 3 |
| Location: | 6535622 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g195450 | POC11 | Proteome of centriole protein 11; (1 of 1) K16757 - coiled-coil domain-containing protein 77 (CCDC77) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCGGCGCTGCTTGAGGACCGGCGCATCC |
| Internal bar code: | CGGGGGGCACCGTGTAACCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 99 |
| LEAP-Seq percent confirming: | 96.2264 |
| LEAP-Seq n confirming: | 102 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCTCGTGCAGCTTGATGT |
| Suggested primer 2: | CGGGAGCTACAGAAGGTGAC |