| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.096938 |
| Chromosome: | chromosome 3 |
| Location: | 2936940 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g163150 | (1 of 2) K09955 - hypothetical protein (K09955) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAGTCACGTGTGAAGGGGCCATCACTCT |
| Internal bar code: | TCTGGTACGGGAGTGACGCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 75 |
| LEAP-Seq percent confirming: | 87.6847 |
| LEAP-Seq n confirming: | 712 |
| LEAP-Seq n nonconfirming: | 100 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | ATAGCCATGGACACCTGCTC |