| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.096965 |
| Chromosome: | chromosome 9 |
| Location: | 7472789 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g413700 | TPT13,TPT14 | UMAMIT (Usually Multiple Acids Move In and Out Transporters) type transporter; (1 of 3) PTHR11132//PTHR11132:SF125 - SOLUTE CARRIER FAMILY 35 // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAAGTATAAGCCACTCGCACGGCAAGT |
| Internal bar code: | AGCAGGTAAGGTAACTGTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 200 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGACTACTCATGCAGCAAA |
| Suggested primer 2: | TCATGGCAGTTTCTTTGCTG |