Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.097019 |
Chromosome: | chromosome 11 |
Location: | 3058496 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g478950 | (1 of 1) K14567 - U3 small nucleolar RNA-associated protein 14 (UTP14) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTGTGTTTGTAGACTGTGCCTGCCAGAG |
Internal bar code: | TGGTTACATATATGACGGGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2115 |
LEAP-Seq percent confirming: | 99.9231 |
LEAP-Seq n confirming: | 5198 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGTTGTTTTACGGGCTGT |
Suggested primer 2: | TTGGTGTTGTGAGCATTGGT |