| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.097030 |
| Chromosome: | chromosome 3 |
| Location: | 1470840 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g151500 | ATA1 | threonine aldolase; (1 of 1) 4.1.2.42 - D-threonine aldolase / Low specificity D-threonine aldolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGCTACGCTTACGTCACCACGTGGCCG |
| Internal bar code: | GGTTTACGCTACGTGCGCTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 512 |
| LEAP-Seq percent confirming: | 98.7275 |
| LEAP-Seq n confirming: | 931 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACTGTCCAATGACACCTG |
| Suggested primer 2: | TTACTTTGTCCCGTAACCGC |