| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.097070 |
| Chromosome: | chromosome 11 |
| Location: | 1507481 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467745 | GCP3 | (1 of 1) K16570 - gamma-tubulin complex component 3 (TUBGCP3, GCP3); Gamma tubulin interacting protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCTTTGAGGCACTCGACAGTACTCGGGT |
| Internal bar code: | TCACGGGACTGGATCCTCTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 285 |
| LEAP-Seq percent confirming: | 62.1677 |
| LEAP-Seq n confirming: | 304 |
| LEAP-Seq n nonconfirming: | 185 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTCCCTTCTTGCTACGC |
| Suggested primer 2: | GTTAATTTCTCACCCGCACG |