| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.097124 |
| Chromosome: | chromosome 3 |
| Location: | 8217655 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g199800 | HYD1,HYDA1 | (1 of 2) 1.12.7.2 - Ferredoxin hydrogenase / Uptake hydrogenase; Iron hydrogenase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGCGCTGTACAACCTGGACGAGAAGTG |
| Internal bar code: | TGGGCGACTGTTTCGGATTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 724 |
| LEAP-Seq percent confirming: | 99.6537 |
| LEAP-Seq n confirming: | 1439 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCATTATCCAAGGCCAGT |
| Suggested primer 2: | GTTTATCACGTCGCTGAGCA |