| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.097238 |
| Chromosome: | chromosome 17 |
| Location: | 3646694 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g726500 | ORC4 | Origin recognition complex subunit 4; (1 of 1) K02606 - origin recognition complex subunit 4 (ORC4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACTATCTACCCCCTTGCGCTTTCCAAA |
| Internal bar code: | TTGTATGACTCTACTGGTGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 371 |
| LEAP-Seq percent confirming: | 99.2663 |
| LEAP-Seq n confirming: | 1353 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGTGGCGGTTTATGAGGT |
| Suggested primer 2: | CTCATGCCATTTAGCAAGCA |