Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.097258 |
Chromosome: | chromosome 3 |
Location: | 3185514 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g165250 | (1 of 1) PF01248//PF12874 - Ribosomal protein L7Ae/L30e/S12e/Gadd45 family (Ribosomal_L7Ae) // Zinc-finger of C2H2 type (zf-met) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGTACCAAAGCCGCATTTATTTGCTTCA |
Internal bar code: | GGTGGATCCGAATTATTATGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 620 |
LEAP-Seq percent confirming: | 99.1383 |
LEAP-Seq n confirming: | 4947 |
LEAP-Seq n nonconfirming: | 43 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTTCCGAACCCAACACAAC |
Suggested primer 2: | CAAGACCCGGCTGTTTGTAT |