Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.097275 |
Chromosome: | chromosome 10 |
Location: | 3763853 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g446650 | HEL46,MER | (1 of 1) K15271 - ATP-dependent DNA helicase HFM1/MER3 [EC:3.6.4.12] (HFM1, MER3); conserved protein with DEAD/DEAH box helicase domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCGCATCCGTCCTCCAATGGATCAGTA |
Internal bar code: | GACGGCTGGGGAGCCCACGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 106 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 102 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCAGGTGTAGGGGAATGT |
Suggested primer 2: | GGTCTCTCTAGTTCACGGCG |