| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.097327 |
| Chromosome: | chromosome 9 |
| Location: | 444456 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404500 | SFI1 | Spindle pole body protein; (1 of 3) K16489 - protein SFI1 (SFI1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATCAACTAATCAGCAGGAATTCTCTAGC |
| Internal bar code: | CCACACCTGGCCTCGTAGTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 519 |
| LEAP-Seq percent confirming: | 96.0894 |
| LEAP-Seq n confirming: | 172 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAAGTGGAGACCTTCTGG |
| Suggested primer 2: | GGTCGATTGGCCTGAATAAA |