Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.097347 |
Chromosome: | chromosome 12 |
Location: | 8450219 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g548300 | TMEM107 | (1 of 1) PF14995 - Transmembrane protein (TMEM107); Transmembrane protein 107 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCCACCCGCCACCTGAGCTGTGGGTGC |
Internal bar code: | GGGTAATTGACTTTAGAAAAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 739 |
LEAP-Seq percent confirming: | 99.3243 |
LEAP-Seq n confirming: | 735 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAAAAGGAAGCCCAAACA |
Suggested primer 2: | GGACTGTGTTACGGAGCCAT |