| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.097392 |
| Chromosome: | chromosome 2 |
| Location: | 1924070 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g087850 | PTK19 | Protein tyrosine kinase; (1 of 2) 2.7.10.2//2.7.11.25 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Mitogen-activated protein kinase kinase kinase / MLTK | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTGCCTCACATACCCGCCAGGGGCACCA |
| Internal bar code: | GCGCACCCCGGAGGCGTCAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 509 |
| LEAP-Seq percent confirming: | 99.6305 |
| LEAP-Seq n confirming: | 809 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCTAGCCGCTTTCCATGT |
| Suggested primer 2: | CCCACCTTGGAGGTCTTGTA |