Insertion junction: LMJ.RY0402.097442_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.097442
Chromosome:chromosome_6
Location:7923465
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g303400 FAP16 Flagellar Associated Protein sense CDS/intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGGGTGCCGTCGTTGAGCGCGATGGGCTT
Internal bar code:TGTTTGCGGGTCTTGAAGCAGG

Confirmation - LEAP-Seq

LEAP-Seq distance:1044
LEAP-Seq percent confirming:99.6134
LEAP-Seq n confirming:5669
LEAP-Seq n nonconfirming:22
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:GCTGTCTGCCTTACTTTGCC
Suggested primer 2:AGCATGTCAGTCAGCCACAG