| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.097444 |
| Chromosome: | chromosome 11 |
| Location: | 423582 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467584 | (1 of 3) 2.7.11.17//2.7.11.25 - Calcium/calmodulin-dependent protein kinase / Microtubule-associated protein 2 kinase // Mitogen-activated protein kinase kinase kinase / MLTK | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGTCGGGCATTTGCCCGCCTAGTCAGTT |
| Internal bar code: | ATAAACAACCGCGTTCGAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 112 |
| LEAP-Seq percent confirming: | 60.2726 |
| LEAP-Seq n confirming: | 619 |
| LEAP-Seq n nonconfirming: | 408 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTGATCGACTACCTCACC |
| Suggested primer 2: | GGTGCTTGGTATTGATGGCT |