| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.097471 |
| Chromosome: | chromosome 16 |
| Location: | 6638477 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g671750 | PFD4 | Prefoldin beta-like protein; (1 of 1) K09550 - prefoldin subunit 4 (PFDN4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACCGGACTGAGGTGGTAGTGGTGGTAGT |
| Internal bar code: | GCTTTTTTCTACTCGGTATTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 803 |
| LEAP-Seq percent confirming: | 99.8442 |
| LEAP-Seq n confirming: | 1922 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAGCACAATATGGCTGCCC |
| Suggested primer 2: | GCACATGGCCAATGTTACAG |