Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.097477 |
Chromosome: | chromosome 2 |
Location: | 1119359 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g081300 | (1 of 13) IPR000086//IPR015797 - NUDIX hydrolase domain // NUDIX hydrolase domain-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTCGTCGGGGGCTCGGCCCGGGGCAGC |
Internal bar code: | GCGCCCTGACCAATAACTCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 814 |
LEAP-Seq percent confirming: | 97.8152 |
LEAP-Seq n confirming: | 3313 |
LEAP-Seq n nonconfirming: | 74 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACCGACGCCAAGAATACAC |
Suggested primer 2: | TCAGCATCTGAGCACCAAAC |