| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.097582 |
| Chromosome: | chromosome 8 |
| Location: | 4485021 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g382515 | (1 of 1) PTHR22838//PTHR22838:SF0 - WD REPEAT PROTEIN 26-RELATED // WD REPEAT-CONTAINING PROTEIN 26 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGCAAGGTGAAGCGTGTTCGGACACAAA |
| Internal bar code: | AACGCAACCCGGACACACCCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 236 |
| LEAP-Seq percent confirming: | 98.3014 |
| LEAP-Seq n confirming: | 2257 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTAGTTGCGTTGTTGCTGT |
| Suggested primer 2: | CCACCTACACCCACACACAC |