| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.097621 |
| Chromosome: | chromosome 6 |
| Location: | 1763386 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g262100 | GSR1,GSHR1 | (1 of 2) 1.8.1.7 - Glutathione-disulfide reductase / NADPH:oxidized-glutathione oxidoreductase; Glutathione reductase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGACGCCAGTGGCGCTGATGGAGGGCATG |
| Internal bar code: | CCATCATGTAACATTTCTGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 503 |
| LEAP-Seq percent confirming: | 98.3979 |
| LEAP-Seq n confirming: | 4115 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGGGTCAGTGTTTGATG |
| Suggested primer 2: | ACTTCCCCGTTTATTTTGGG |