| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.097630 |
| Chromosome: | chromosome 2 |
| Location: | 814629 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g078966 | FTSH9,FHL5 | FtsH-like ATPase/metalloprotease; (1 of 1) PTHR23076//PTHR23076:SF70 - METALLOPROTEASE M41 FTSH // ATP-DEPENDENT ZINC METALLOPROTEASE FTSH 7, CHLOROPLASTIC-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCACCACGCCGTCCTTCTCGCCCTCTGG |
| Internal bar code: | AGCGGTAACTCGGGTTGTGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 666 |
| LEAP-Seq percent confirming: | 90.0099 |
| LEAP-Seq n confirming: | 1820 |
| LEAP-Seq n nonconfirming: | 202 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTCCAGTCCTCTTGCAC |
| Suggested primer 2: | CGTACCCAACGCTACCCTAA |