Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.097634 |
Chromosome: | chromosome 8 |
Location: | 360238 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g358571 | (1 of 5) IPR001054//IPR006189//IPR029787 - Adenylyl cyclase class-3/4/guanylyl cyclase // CHASE domain // Nucleotide cyclase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGCCTCATCCATGTTGTGGATTGTCTACG |
Internal bar code: | CACTCCCAGGAGCGTCAGTGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 65 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGCAGGCAAGTACAACAA |
Suggested primer 2: | TAGTGCAATTTTGGCATGGA |