| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.097662 |
| Chromosome: | chromosome 4 |
| Location: | 1999172 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g218800 | THB3 | (1 of 1) IPR001486//IPR008207//IPR009050 - Truncated hemoglobin // Signal transduction histidine kinase, phosphotransfer (Hpt) domain // Globin-like; Truncated hemoglobin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCAGGTGGGCCGGTCCTCGGTCTTGGGG |
| Internal bar code: | CCCTACCAAACGTCAAAACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 563 |
| LEAP-Seq percent confirming: | 74.8841 |
| LEAP-Seq n confirming: | 5167 |
| LEAP-Seq n nonconfirming: | 1733 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTACGCTTCAGAATTTGCC |
| Suggested primer 2: | AGGTGTCAACCGACTGCTCT |