| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.097672 |
| Chromosome: | chromosome 4 |
| Location: | 3094453 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g225600 | CGL104 | mitochondrial glycoprotein family protein; (1 of 1) PTHR10826:SF1 - COMPLEMENT COMPONENT 1 Q SUBCOMPONENT-BINDING PROTEIN, MITOCHONDRIAL | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCGGTTGGCGTATGTCCTTGCACCCCGT |
| Internal bar code: | GCAGTCGGCCGTCGGCACCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 381 |
| LEAP-Seq percent confirming: | 99.6081 |
| LEAP-Seq n confirming: | 2542 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATGAGCGCGAAAGCTACC |
| Suggested primer 2: | GAACTCCTGTACGGCTGAGG |