| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.097704 |
| Chromosome: | chromosome 8 |
| Location: | 483296 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358751 | ZMY10,ZMYND10,DNAAF7 | (1 of 1) PTHR13244//PTHR13244:SF7 - ZINC FINGER MYND DOMAIN CONTAINING PROTEIN 10 // ZINC FINGER MYND DOMAIN-CONTAINING PROTEIN 10; Zinc finger MYND-Type containing protein 10 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCTCCCAGCTCCCCCACCTCCTCCCCA |
| Internal bar code: | GCCTACCCCTAGTCCGTGAACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 162 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGACAAACACACACACACA |
| Suggested primer 2: | GCTAAACCAGCTGAGGAACG |