Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.097721 |
Chromosome: | chromosome 6 |
Location: | 6245676 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g290900 | (1 of 1) PF06294//PF11971 - CH-like domain in sperm protein (CH_2) // CAMSAP CH domain (CAMSAP_CH) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGAGATGGGGTAGGATGGCGGGCCCAG |
Internal bar code: | TCTCCGGAGCTTTGGTCGATGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 90 |
LEAP-Seq percent confirming: | 76.5217 |
LEAP-Seq n confirming: | 264 |
LEAP-Seq n nonconfirming: | 81 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACTGTACGTGCGTGCTTC |
Suggested primer 2: | CTTTAGCGATGGAGGTGAGC |