| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.097766 |
| Chromosome: | chromosome 2 |
| Location: | 1447929 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g083750 | ROC75 | (1 of 1) IPR006447//IPR009057//IPR017930 - Myb domain, plants // Homeodomain-like // Myb domain; Rhythm Of Chloroplast 75 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCACGAGCGGCCAAATTTCCGCCCAGG |
| Internal bar code: | GCATCCGTGCGACAAAAGGAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 639 |
| LEAP-Seq percent confirming: | 98.6214 |
| LEAP-Seq n confirming: | 12805 |
| LEAP-Seq n nonconfirming: | 179 |
| LEAP-Seq n unique pos: | 94 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGGAAGAGGGAAGACGAGC |
| Suggested primer 2: | GTGTCTTAGAGGCGTGCTCC |