| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.097982 |
| Chromosome: | chromosome 17 |
| Location: | 3261861 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g722900 | (1 of 781) IPR000104 - Antifreeze protein, type I | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATTCCGTCAGTTGCAAGGCCTGCAACTCG |
| Internal bar code: | TGTTGGAGATGACGGTTGTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 556 |
| LEAP-Seq percent confirming: | 94.8025 |
| LEAP-Seq n confirming: | 3192 |
| LEAP-Seq n nonconfirming: | 175 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCCTATGCCTAACAACGC |
| Suggested primer 2: | TTAGGAATGGTCTTTGCGCT |