| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.097994 |
| Chromosome: | chromosome 14 |
| Location: | 3484085 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630811 | (1 of 6) 3.4.19.12//3.4.22.69 - Ubiquitinyl hydrolase 1 / Ubiquitin thiolesterase // SARS coronavirus main proteinase / Severe acute respiratory syndrome coronavirus main protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCATTGTAGCAAGGCAGGGTCATGGCT |
| Internal bar code: | GCCCGCGTGGCCATTAGGTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 504 |
| LEAP-Seq percent confirming: | 99.0055 |
| LEAP-Seq n confirming: | 2688 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGCCTCATGACATCTACA |
| Suggested primer 2: | TCTACTCATACTCGCCGCCT |