Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.098063 |
Chromosome: | chromosome_7 |
Location: | 2494317 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre07.g329476 | sense | 3'UTR | ||
Cre07.g329500 | SUB1 | Secreted protease and protease inhibitor | sense | 5'UTR|outside_mRNA |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | AGGCTTAGCACGTGCGAGCTGCTGCAGGCC |
Internal bar code: | AATGGGCTGGATTGCGATCGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 777 |
LEAP-Seq percent confirming: | 99.2316 |
LEAP-Seq n confirming: | 1808 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCAGAAGACAAGTTGGTCG |
Suggested primer 2: | ATCGGCGTAGTAGCAGCATT |