| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.098068 |
| Chromosome: | chromosome 7 |
| Location: | 4050305 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g340300 | Protein tyrosine kinase; (1 of 41) IPR000719//IPR011009 - Protein kinase domain // Protein kinase-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCGGCCTCAGGTGACGGCAGCCGCCTGG |
| Internal bar code: | AGGGCAACGTAGGGGATGGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 458 |
| LEAP-Seq percent confirming: | 99.4375 |
| LEAP-Seq n confirming: | 1591 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAACGTCATTGTGAGTGG |
| Suggested primer 2: | GGCTTGGCTAGGACTCACTG |