| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.098097 |
| Chromosome: | chromosome 12 |
| Location: | 6833828 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g561200 | COPZ2 | Zeta2 subunit of COP-I complex; (1 of 1) PTHR11043//PTHR11043:SF1 - ZETA-COAT PROTEIN // F9L1.32 PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAAAGTGTAGGTGGTGGCCTGGGATCCG |
| Internal bar code: | GCGTACTCGGTCCCTACAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 261 |
| LEAP-Seq percent confirming: | 97.329 |
| LEAP-Seq n confirming: | 3316 |
| LEAP-Seq n nonconfirming: | 91 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATTGCTCTGCGTCATCTCG |
| Suggested primer 2: | GATAAGCGAGGGTCAAACCA |