Insertion junction: LMJ.RY0402.098130_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.098130
Chromosome:chromosome_8
Location:4151437
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):ACTGCTTGGCGGCGGCGGGACAGGCGGCGG
Internal bar code:CGCCGACGAAAACAGAAGGGAA

Confirmation - LEAP-Seq

LEAP-Seq distance:552
LEAP-Seq percent confirming:45.4721
LEAP-Seq n confirming:2119
LEAP-Seq n nonconfirming:2541
LEAP-Seq n unique pos:24

Suggested primers for confirmation by PCR

Suggested primer 1:TTGTAACGACAGCTTGCGAC
Suggested primer 2:TTTTCCTGTGCTTTCCTGCT