| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.098151 |
| Chromosome: | chromosome 9 |
| Location: | 1727963 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396700 | ACK1 | (1 of 2) 2.7.2.1 - Acetate kinase / AK; Acetate kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGACATGCGGGGTCGGGGCATGCACCAAT |
| Internal bar code: | GTCATCGTCGTGGCGCCTTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 293 |
| LEAP-Seq percent confirming: | 96.3027 |
| LEAP-Seq n confirming: | 2214 |
| LEAP-Seq n nonconfirming: | 85 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTACGTGGTCATGTGAAG |
| Suggested primer 2: | TACTTGTGGCTAGTGCCGTG |