| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.098227 |
| Chromosome: | chromosome 9 |
| Location: | 1976823 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394800 | MITC16, MCP16 | Mitochondrial substrate carrier protein; (1 of 3) K05863 - solute carrier family 25 (mitochondrial adenine nucleotide translocator), member 4/5/6/31 (SLC25A4S, ANT) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCCACGCTGGCTGGGAGGCGCGTTGAGG |
| Internal bar code: | CGGTCGGGAGCGGACCGAGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 643 |
| LEAP-Seq percent confirming: | 99.2571 |
| LEAP-Seq n confirming: | 2004 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACTACCACTGGCCGTGTC |
| Suggested primer 2: | GAAATAGGTGGCGTCGGTAA |