| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.098229 |
| Chromosome: | chromosome 12 |
| Location: | 5194128 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g527700 | CYG19 | (1 of 2) IPR001054//IPR029016//IPR029787 - Adenylyl cyclase class-3/4/guanylyl cyclase // GAF domain-like // Nucleotide cyclase; Adenylate/guanylate cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTCCAGTCAGGCGGCAGCGTTGGCAGCA |
| Internal bar code: | ACGTTCGGGACGCGATAAGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 743 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCAGGACATCTACCCCT |
| Suggested primer 2: | CAGCGACACTCACCCTTGTA |