| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.098233 |
| Chromosome: | chromosome 13 |
| Location: | 3255319 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g585900 | LKHA4,LTA4 | (1 of 1) 3.3.2.6 - Leukotriene-A(4) hydrolase / LTA-4 hydrolase; Leukotriene A-4 hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCCCCCGCCCTTAACTGTGCCCCTCCC |
| Internal bar code: | ACTCGTTTATGATCAATGCTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1095 |
| LEAP-Seq percent confirming: | 99.582 |
| LEAP-Seq n confirming: | 5479 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACATTGCAACTTTCCCCT |
| Suggested primer 2: | CGACACGAGGTTGGGTAGAT |